View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_39 (Length: 251)
Name: NF20884_low_39
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 41359142 - 41358918
Alignment:
| Q |
9 |
gagatgaacatggctcaacaggtactcttttgactattatattcatatgttagtttttggaattttcctcatgaattttcattgtattcatgnnnnnnnn |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
41359142 |
gagaagaacatggctcaacaggtactcttttgactattatattcatatattagtttttggaattttc-------------attgtattcatgtttttttt |
41359056 |
T |
 |
| Q |
109 |
nn-atacaatggatttgatgttagaatgaggggtggccactgggtttacagccactgcatgcaaggatggagattgttagtaattggaacaactctggat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41359055 |
tttatacaatggatttgatgttagaatgaggggtggccactgggtttacagccactgcatgcaaggatggagattgttagtaatgggaacaactctggat |
41358956 |
T |
 |
| Q |
208 |
caatgtcatttaacaccttgctcagtgattctccttct |
245 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
41358955 |
caatgtcatttaacaccttgcttagtggttcttcttct |
41358918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University