View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_42 (Length: 242)
Name: NF20884_low_42
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 12539854 - 12540077
Alignment:
| Q |
1 |
cctcctcctcgtccttttgtttcataccttattcgttccttctcttcagctacaattacagaacccttgctctttaatcctgaaactcttgatcattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
12539854 |
cctcctcctcgtccttttgtttcataccttattcgttccttctcttcaagtacaattacagaacccttgtactttaatcttgaaactcttgatcattttt |
12539953 |
T |
|
| Q |
101 |
ctgctattcgaatatttgatctgatgctcgattacgatggcttctattccatatccgattttaacttccttttttcttcccttatcaaaaagggttccct |
200 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12539954 |
ctgctattcgtatattcgatctgatgctcgattacgatggcttctattccatatccgattttaacttccttttttcttcccttatcaaaaagggttgcct |
12540053 |
T |
|
| Q |
201 |
caggactgtttttcaacttgctca |
224 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
12540054 |
cttgactgtttttcaacttgctca |
12540077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University