View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_45 (Length: 238)
Name: NF20884_low_45
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 10601763 - 10601555
Alignment:
| Q |
15 |
gaatataaatttaaattcttgttcgaataatcattgatcagactttacttaatcaaccgagtttcaaattattagaatctttaactaagtttgtaattta |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
10601763 |
gaatataaatttaaattcttgttctaataatcattgatcagactgtacttaatcaaccgagtttcgaattatcaaaatctttaactaagtttgtaattta |
10601664 |
T |
|
| Q |
115 |
atggcatgcaggttagaaacagttaacttgnnnnnnnttcacagcatagcaaagatagttggaacagtagtaactgtatcaggagcaatggttatgacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10601663 |
atggcatgcaggttagaaacagttaacttgaaaaaaattcacagcatagcaaagatagttggaacagtagtaactgtatcaggagcaatggttatgacat |
10601564 |
T |
|
| Q |
215 |
tgtacaaag |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
10601563 |
tgtacaaag |
10601555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University