View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_53 (Length: 215)
Name: NF20884_low_53
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 200
Target Start/End: Complemental strand, 8757116 - 8756933
Alignment:
| Q |
17 |
cacagagaatggtcgtagtctaacaataaaggcattccaaacatctaaaactcgaatagttcaaaaggtctttcaatcttatgggtacttttattcttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8757116 |
cacagagaatggtcgtagtctaacaataaaggtattccaaacatctaaaactcgaatagttcaaaaggtctttcaatcttatgggtacttttattctcaa |
8757017 |
T |
|
| Q |
117 |
aaggtctggtatccagaagtatattgaaattaaaatcataactggtagctgagtctagtcgcagctgggttccttagtttgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757016 |
aaggtctggtatccagaagtatattgaaattaaaatcataactggtagctgagtctagtcgcagctgggttccttagtttgatt |
8756933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University