View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20884_low_55 (Length: 210)

Name: NF20884_low_55
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20884_low_55
NF20884_low_55
[»] chr7 (1 HSPs)
chr7 (20-198)||(25131862-25132040)


Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 25131862 - 25132040
Alignment:
20 tttttcacttccattcctctttgtttggcttcagtggctgtataaactgacaggtattttggaactttattggcttcacttccattccccttcccttctg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
25131862 tttttcacttccattcctctttgtttggcttcagtggctgtataaactgacaggtcttttggaactttattggcttcacttccattccccttcccttctg 25131961  T
120 ttttgcttcacttcttgttagggcatatccctttgttacaaccctgctgtgtctcttatggaaatttctcttcatttca 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
25131962 ttttgcttcacttcttgttagggcatatccctttgttacaaccctgctgtgtctcttatggaaatttctcttcttttca 25132040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University