View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20884_low_56 (Length: 202)
Name: NF20884_low_56
Description: NF20884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20884_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 3290653 - 3290472
Alignment:
| Q |
15 |
caaaggataatgagggaagtgacttcacaagcatgtctacgtggtat----------agtaggtcttagggttttgaaacattcannnnnnnnnatatat |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
3290653 |
caaaggatgatgagggaagtgacttcacaagcatgtctacgtggtattacagtcacaagtaggtcttagggttttaaaacatttttttttttttttatat |
3290554 |
T |
 |
| Q |
105 |
ttatccaaagtaacttgacaagtaagtcaagaacccatgtgaatacgtggtattacagtcaccaaaaatctaaggaaaaaac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3290553 |
ttatccaaagtaacttgacaagtaagtcaagaacccatgtgaatacgtggtattacagtcaccaaaaatctaaggaaaaaac |
3290472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University