View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_high_40 (Length: 295)
Name: NF20885_high_40
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 32504895 - 32504633
Alignment:
| Q |
19 |
aggagcaacaagtaaataataataatttagcatcaagtcatcaaccaccttattgattaatttgattccgtccaaaaaacaaatttaattgcttttgcat |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504895 |
aggagcaacaagtaaataataat---ttagcatcaagtcatcaaccaccttattgattaatttgattccgtccaaaaaacaaatttaattgcttttgcat |
32504799 |
T |
 |
| Q |
119 |
gtgaaaattgtacaggatacggtccattgaaatgtataagattggtgtgtattaatatcatatcattctcttcactcttcagagatcaaaccggcaccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504798 |
gtgaaaattgtacaggatacggtccattgaaatgtataagattggtgtgtattaatatcatatcattctcttcactcttcagagatcaaaccggcaccaa |
32504699 |
T |
 |
| Q |
219 |
catgcattatggagctgtcctactctcaaacacgaatttaaggcaggcattttgttcttctttctt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504698 |
catgcattatggagctgtcctactctcaaacacgaatttaaggcaggcattttgttcttctttctt |
32504633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University