View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_high_60 (Length: 247)
Name: NF20885_high_60
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_high_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 231
Target Start/End: Original strand, 8154954 - 8155177
Alignment:
| Q |
8 |
atgtcgaagaatatggccggaaaataaaatctgactatataactagtttggattacatggaaatggattatactttatttttgagtctttgcattcgaat |
107 |
Q |
| |
|
|||||||| | |||||||| |||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154954 |
atgtcgaaaattatggccgaaaaataaaatctaactatttaactagttttgattacatggaaatggattatactttatttttgagtctttgcattcgaat |
8155053 |
T |
 |
| Q |
108 |
gtcctcaagtataagacgtgtctctctgcgtgcctcattactacattgtctataacatagtactannnnnnnggtagagatctctaattctttcatctca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
8155054 |
gtcctcaagtataagacgtgtctctctgcgtgcctcattactacattgtctataacattgtaccatttttttggtagagatctctaattctttcatctca |
8155153 |
T |
 |
| Q |
208 |
tccaaaactatttgtctgttcctg |
231 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
8155154 |
tctaaaactatttgtctgttcctg |
8155177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University