View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_low_32 (Length: 335)
Name: NF20885_low_32
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 7 - 200
Target Start/End: Original strand, 29170186 - 29170380
Alignment:
| Q |
7 |
gtgagatgaaagaaagaagaacctgatctagga-ttgtatcaaacaccttgaaggcttgttcttcatcaagcagttttgtctgcgttggaccagtacaaa |
105 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
29170186 |
gtgagacgaaagaaagaaaaacctgatctaagaattgtatcaaacaccttgaaggcttgttcttcatcaagcggtttggtttgcgttggaccagtacaaa |
29170285 |
T |
 |
| Q |
106 |
ccctggtttgagcatccaacgccgtttgatttggcctagtcaatttcgaactccgataccaagacgacaatgaaggattctgaacgtcgaattcc |
200 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
29170286 |
ccctggtttgagcatccaacacagtttgattcggcctagtcaatttcgaactccgatacgaagacgacaacgaaggattccgaaagtcgaattcc |
29170380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University