View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_low_33 (Length: 323)
Name: NF20885_low_33
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 22 - 306
Target Start/End: Complemental strand, 31627006 - 31626713
Alignment:
| Q |
22 |
gtcccgtcatccacctccgccgccgcaaaacccttcgcatgttcctcactcgtcctcacgaccgccgccgtttccatcctcctcccctagatccacctcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31627006 |
gtcccgtcatccacctccgccgccgcaaaaccctccgcatgttcctcactcgtccgcacgaccgccgccgtttccatcctcctcccctagatccacctcc |
31626907 |
T |
|
| Q |
122 |
tccttcctccgatgaagtcaaagtccgccacaagcttaaagacctattcatctcctcgccatctccgccgtcacttccgtctccgccgacgatgctacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31626906 |
tccttcctccgatgaagtcaaagttcgccacaagcttaaagacctattcgtctcctctccatctccgccgtcacttccgtctccgccgacgatgctacaa |
31626807 |
T |
|
| Q |
222 |
gacgagaagaatatctcccaacagc---------agcagaattacgatcagaaagattgctccaccgtcgctgtccgattccgaactggatctc |
306 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31626806 |
gacgagaagaatatctcccaacagcagcaacagcagcagaattacgatcagaaagattgctccaccgtcgctgtccgattccgaactggatctc |
31626713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University