View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_low_65 (Length: 239)
Name: NF20885_low_65
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 48 - 200
Target Start/End: Complemental strand, 33433630 - 33433478
Alignment:
| Q |
48 |
attttctcgtttcattcgatccaaacacctgccttcagcaactattaaacttcaactcaaatttcaacttatttctttccttagtaatgttcctcctgag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33433630 |
attttctcgtttcattcgatccaaacacctgccttcagcaactattaaacttcaactcaaatttcaacttatttctttccttagtaatgttcctcctgag |
33433531 |
T |
|
| Q |
148 |
gataacagcattctagaggtgcgtgcccttatttttattgattcaataatcat |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33433530 |
gataacagcattctagaggtgtgtgcccttatttttattgattcaataatcat |
33433478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 33433673 - 33433705
Alignment:
| Q |
21 |
tcatagtcacagaggcttttgcgcctaattttc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33433673 |
tcatagtcacagaggcttttgcgcctaattttc |
33433705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University