View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_low_67 (Length: 236)
Name: NF20885_low_67
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34361022 - 34360806
Alignment:
| Q |
1 |
acgtgatagaggatggagcagatgagttggttttaagccaattatatgcgctgttttgtgagtaaaattcaggatttgagaatccgatcttctgccagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361022 |
acgtgatagaggatggagcagatgagttggttttaagccaattatatgcgctgttttgtgagtaaaattcaggatttgagaatccgatcttctgccagat |
34360923 |
T |
 |
| Q |
101 |
tgcagtagagaatttatagtcatcaattttctatcgccgtggctgttatgtttcaatattatattggtataactttcaattgtagcagtggacttactca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
34360922 |
tgcagtagagaatttatagtcatcaattttctatcgccg----tgttatgtttcaatattatattggtataactttcaattgtaggagttgacttactca |
34360827 |
T |
 |
| Q |
201 |
aataaagtttccagaaaattg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34360826 |
aataaagtttccagaaaattg |
34360806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 120 - 221
Target Start/End: Complemental strand, 17332769 - 17332667
Alignment:
| Q |
120 |
tcatcaattttctatcgccgtggctgttatgtttcaatattatattggtataactttcaattgtagcagtggacttactcaaataaag-tttccagaaaa |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17332769 |
tcatcaattttctatcgccatggctgttatgtttcaatattatattggtataactttcaattgtagcagtggacttactcaaataaagttttccagaaaa |
17332670 |
T |
 |
| Q |
219 |
ttg |
221 |
Q |
| |
|
||| |
|
|
| T |
17332669 |
ttg |
17332667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University