View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20885_low_80 (Length: 209)
Name: NF20885_low_80
Description: NF20885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20885_low_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 6863548 - 6863424
Alignment:
| Q |
1 |
aagaatttgctgccaatcctactgcatacgctgcattcaaaggcaaacatgctccgtccaaatattgtgatacccttttgttataattgtcaatcctact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
6863548 |
aagaatttgctgccaatcctactgtatacgctgcattcaaaggcaaacatgctccgtccaaatattgtgataccatttgcttataattgccaatcctact |
6863449 |
T |
 |
| Q |
101 |
gcatcatgtattatacaaacatgat |
125 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
6863448 |
gcatcatgtattatacgaacatgat |
6863424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 6863428 - 6863390
Alignment:
| Q |
165 |
atgatttgttttgtgcctgcattgcttgtcctttgcttc |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6863428 |
atgatttgttttgtgccagcattgcttgtcctttgcttc |
6863390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University