View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20887_low_10 (Length: 255)
Name: NF20887_low_10
Description: NF20887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20887_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 24201197 - 24201415
Alignment:
| Q |
17 |
attctagtggtaataatgatgatgatggtggnnnnnnnggcggtggtggcggtggaggtagagaactccagttgatccgaggttctggatttggtggttg |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201197 |
attctagtggtaataatgatgatggtggtggaaaaaaaggcggtggtggcggtggaggtagagaactccagttgatccgaggttctggatttggtggttg |
24201296 |
T |
 |
| Q |
117 |
tgatggcagtagcgacggttgtgaagaccgctgattgatttgaggttcggagtttacaggttgaaattgtagcggtggtactgatcgtactgatagtcgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201297 |
tgatggcagtagcgacggttgtgaagaccgctgattgattcgaggttctgagtttacaggttgaaattgtagcggtggtactgatcgtactgatagtcgt |
24201396 |
T |
 |
| Q |
217 |
gatggtgtaaaaaacggaa |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24201397 |
gatggtgtaaaaaacggaa |
24201415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University