View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20887_low_12 (Length: 220)
Name: NF20887_low_12
Description: NF20887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20887_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 121
Target Start/End: Original strand, 38760502 - 38760610
Alignment:
| Q |
15 |
aatataaggagagtggtggaacacgaaaaacaacacatcaaagatttgttcaccatattcggtctaacaataacttacatatgta--agagagatatctt |
112 |
Q |
| |
|
||||||| |||||| ||||||||| | |||||||||||||||||||||||||||| |||||| ||||||||||||| |||||| |||||||| |||| |
|
|
| T |
38760502 |
aatataaagagagtagtggaacaccgagaacaacacatcaaagatttgttcaccatgttcggttcaacaataacttacttatgtaagagagagatctctt |
38760601 |
T |
 |
| Q |
113 |
agcttcact |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
38760602 |
agcttcact |
38760610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University