View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20888_high_13 (Length: 227)

Name: NF20888_high_13
Description: NF20888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20888_high_13
NF20888_high_13
[»] chr7 (2 HSPs)
chr7 (120-206)||(47692012-47692101)
chr7 (14-54)||(47692167-47692208)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 206
Target Start/End: Complemental strand, 47692101 - 47692012
Alignment:
120 tgggatcgatggagtgtgatg---gatcgagtggttcttggaagagacagacattcttcaacacgccctgtaacttcgcttcttcccttt 206  Q
    |||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47692101 tgggatcgatggagtgtgatgatggatcgagtggttcttggaagagacagacattcttcaacacgccctgtaacttcgcttcttcccttt 47692012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 47692208 - 47692167
Alignment:
14 gagcacagagagaaacaaaa-gtgtgatggtagcgtgaattg 54  Q
    ||||| |||||||||||||| |||||||||||||||||||||    
47692208 gagcatagagagaaacaaaaagtgtgatggtagcgtgaattg 47692167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University