View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20888_low_11 (Length: 250)
Name: NF20888_low_11
Description: NF20888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20888_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 20670527 - 20670767
Alignment:
| Q |
1 |
tttaatgtatggaaaataaaatattaaaatttcattcacatatgcgatgccacatcaccctgtgacttgctagcttattattaaacttgacatatcagca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20670527 |
tttaatgtatggaaaataaaataataaaatttaattcacatatgcgatgccacatcaccctgtgacttgttagcttattattaaacttgacatatcagca |
20670626 |
T |
|
| Q |
101 |
aaaataagtctcaacttcagtggtagagaaaatttatgaaattttaacaactaggtttagaaattgaaggactaaaatcgtgaatcaacaaaaataggac |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20670627 |
aaaataagtctcaacttcagtggtgcagaaaatttatgaaattttaacaactaggtttagaaattgaaggactaaaatcgtgaatcaacaaaaataggac |
20670726 |
T |
|
| Q |
201 |
taaaagtgcatttaaacttatatatgtatataggtctgtgc |
241 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| || ||||| |
|
|
| T |
20670727 |
taaaagtgcatttaatcttctatatgtatatatgtgtgtgc |
20670767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 139
Target Start/End: Complemental strand, 27547365 - 27547289
Alignment:
| Q |
63 |
tgacttgctagcttattattaaacttgacatatcagcaaaaataagtctcaacttcagtggtagagaaaatttatga |
139 |
Q |
| |
|
|||||||| |||| |||||| ||||||||| ||||||||| |||| |||| | |||||||||||||||||||||||| |
|
|
| T |
27547365 |
tgacttgccagctcattattcaacttgacacatcagcaaatataactctcgaattcagtggtagagaaaatttatga |
27547289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University