View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20888_low_13 (Length: 227)
Name: NF20888_low_13
Description: NF20888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20888_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 120 - 206
Target Start/End: Complemental strand, 47692101 - 47692012
Alignment:
| Q |
120 |
tgggatcgatggagtgtgatg---gatcgagtggttcttggaagagacagacattcttcaacacgccctgtaacttcgcttcttcccttt |
206 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47692101 |
tgggatcgatggagtgtgatgatggatcgagtggttcttggaagagacagacattcttcaacacgccctgtaacttcgcttcttcccttt |
47692012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 47692208 - 47692167
Alignment:
| Q |
14 |
gagcacagagagaaacaaaa-gtgtgatggtagcgtgaattg |
54 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47692208 |
gagcatagagagaaacaaaaagtgtgatggtagcgtgaattg |
47692167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University