View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20888_low_8 (Length: 326)
Name: NF20888_low_8
Description: NF20888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20888_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 205
Target Start/End: Complemental strand, 20670468 - 20670270
Alignment:
| Q |
7 |
tccaagaatatgcattgtcatcgtgacttgacagctcattgttcaccgacacattagcaaaaaatgaacctaaaatgcagtggtagagaaaatttctgaa |
106 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20670468 |
tccaaaaatatacattgtcatcgtgacttgacagctcattgttcaccgacacatcagcaaaaaataaacctaaaatgcagtggtagagaaaatttctgaa |
20670369 |
T |
 |
| Q |
107 |
atttaaaaatttgatgactatattcttcgatctagaaatatagagaccaaaatcgttaatcaacgaaaataaggagatcaaaagtgtaattaagtcatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20670368 |
atttaaaaatttgatgactatattcttcgatctagaaatatagagaccaaaatcgttaatcaacgaaaataaggagatcaaaagtgtatttaagtcatt |
20670270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 273 - 310
Target Start/End: Complemental strand, 20670202 - 20670165
Alignment:
| Q |
273 |
agatttagacatacttggcgaagtcttcgggcttcttg |
310 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20670202 |
agatttagacatacttggcaaagtcttcgggcttcttg |
20670165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University