View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20889_high_6 (Length: 269)
Name: NF20889_high_6
Description: NF20889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20889_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 52792604 - 52792355
Alignment:
| Q |
1 |
aatttgcaggtattgcatgcttgctatacaaaagtatcaccatcagttgcagtagatgatccacaactcgttgtatggtctgaatccgttgccgaactac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52792604 |
aatttgcaggtattgcatgcttgctatacaaaagtatcaccatcagtttcagtagatgatccacaactcgttgtatggtctgaatccgttgccgaactac |
52792505 |
T |
|
| Q |
101 |
ttgacttagataataacgagttagtctctcacatttctttactcattaatttacttactttcatatcatcatatttcaatctactaactatatttattat |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
52792504 |
ttgacttagataataacgagttagtttctcacatttctttactcatt-atttacttactatcatatcatcatatttcaatctattaacta----tattat |
52792410 |
T |
|
| Q |
201 |
attcattcattcatccactttcagatttcaaagacctgattttccccttttcttctctg |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52792409 |
attcattcatt----cactttcagatttcaaagacctgattttccccttttcttctctg |
52792355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University