View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2088_low_6 (Length: 280)
Name: NF2088_low_6
Description: NF2088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2088_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 56 - 264
Target Start/End: Original strand, 2005668 - 2005876
Alignment:
| Q |
56 |
tcatatggacaaattagtccttctgttatactgaatcaggactaatttgtccccggtataaaaatgtcacactactttgggttttattgttgcacggact |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2005668 |
tcatatggacaaattagtccttctgttatactgaatcaggactaatttgtccccggtataaaaatgtcacactactttgggttttattgttgcagggact |
2005767 |
T |
|
| Q |
156 |
aaatcggcccacacgaaaattgtgaagaccaaattggttttcactcttaatatagattaaaaaataattacacatgtagtttatctaaaatcaatcttgc |
255 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2005768 |
aaatcggcccacatgaaaattgtgaagaccaaatcggttttcactcttaatatagattaaaaaataattacacatgtagtttatgtaaaatcaatcttgc |
2005867 |
T |
|
| Q |
256 |
attcatctc |
264 |
Q |
| |
|
|||||||| |
|
|
| T |
2005868 |
gttcatctc |
2005876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 122
Target Start/End: Original strand, 33328811 - 33328855
Alignment:
| Q |
79 |
tgttatactgaatcag-gactaatttgtccccggtataaaaatgt |
122 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
33328811 |
tgttatactgaattagagactaatttatccccggtataaaaatgt |
33328855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University