View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2089-Insertion-11 (Length: 224)
Name: NF2089-Insertion-11
Description: NF2089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2089-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 10327634 - 10327418
Alignment:
| Q |
8 |
aaaacaaatattatcagaagcagaaaaatgtatctgattcaataaacaatgagatgcataaaaagttaggagcaagaaacataaagaaaatgcstgcaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10327634 |
aaaacaaatattatcagaagcagaaaaatgtatcagattcaataaacaatgagatgcataaaaagttaggagcaagaaacataaagaaaatgtgtgcaac |
10327535 |
T |
 |
| Q |
108 |
taaagtttctatggtttctactacttctgcatcgtctccaacagagcattaatcccatcatttgtctgatcttgcttctttgccatatgtgcttgagtct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10327534 |
taaagtttctatggtttctactacttctgcatcatctccaacagagcattaatcccatcatttgtctgatcttgcttctttgccatatgtgcttgagtct |
10327435 |
T |
 |
| Q |
208 |
tagccatttcagcttgc |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10327434 |
tagccatttcagcttgc |
10327418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University