View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20890_high_8 (Length: 240)
Name: NF20890_high_8
Description: NF20890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20890_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45107789 - 45108010
Alignment:
| Q |
1 |
gagaaacataaaccaatgagcataggggttactaaccccaaaagtgaaatcgtccatccttttcttcctgtccttctgatcatgttgaaatccattttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107789 |
gagaaacataaaccaatgagcataggggttactaaccccaaaagcgaaatcgtccatccttttcttcctgtccttctgatcatgttgaaatccattttca |
45107888 |
T |
|
| Q |
101 |
cgcctgtttcgaacagaaacaacacatagccaagtcctgcaatggttgcaagtgtgtcttgactcccataaggaaacaaattcatcttgaggtccaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45107889 |
cgcctgtttcgaacagaaacaacacataaccaagtcctgcaatggttgcaagtgtgtcttgactcccataaggaaacaaattcctcttgaggtccaaaaa |
45107988 |
T |
|
| Q |
201 |
tattggcactgctggtcctaaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45107989 |
tattggcactgctggtcctaaa |
45108010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University