View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20890_high_9 (Length: 239)
Name: NF20890_high_9
Description: NF20890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20890_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 47258014 - 47257822
Alignment:
| Q |
10 |
catcatcatgtgggactcacatgctgagaaactctgcattcatcatgtgaaatttctccttcttagcagaagtatattattggaatctagtgatctcaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47258014 |
catcatcatgtgggactcacatgctgagaaactctgcattcatcatgtgaaatttctccttcttagcagaagtatattattggaatctagtgatctcaac |
47257915 |
T |
 |
| Q |
110 |
cacaatgcaatgcatgcacaatccaatgattatacaagtcagaatttacattctaataatttctcagatccatccaaattaacacctattctc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47257914 |
cacaatgcaatgcatgcacaatccaatgattatacaagtcagaatttacattctaataatatctcagatccatccaaattaacacctattctc |
47257822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University