View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20890_low_6 (Length: 256)
Name: NF20890_low_6
Description: NF20890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20890_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 101 - 239
Target Start/End: Original strand, 46708914 - 46709052
Alignment:
| Q |
101 |
acgaaatgaaagaatatgtatgtgtcaatgcattagaaaagtttaaaacggttcattgtctatttgaccaaaatcatcggttggatagtcaattaaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46708914 |
acgaaatgaaagaatatgtatgtgtcaatgcattagaaaagtttaaaacggttcattgtctatttgaccaaaatcatcggttggatagtcaattaagtct |
46709013 |
T |
|
| Q |
201 |
aacgacaaaattcacacacattaaaataatgctaagaag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46709014 |
aacgacaaaattcacacacattaaaatagtgctaagaag |
46709052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 46708632 - 46708740
Alignment:
| Q |
1 |
gtctaaaatagaggccagcttcttcgaacaatcatgccaatttttaggttttttgttgtcattgtttgagctatgctaaattttacgaagatgttgacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708632 |
gtctaaaatagaggccagcttcttcggacaatcatgccaatttttaggttttttgttgtcattgtttgagctatgctaaattttacgaagatgttgacaa |
46708731 |
T |
|
| Q |
101 |
acgaaatga |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
46708732 |
acgaaatga |
46708740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University