View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20891_high_9 (Length: 237)
Name: NF20891_high_9
Description: NF20891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20891_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 43805796 - 43805582
Alignment:
| Q |
1 |
atgatattgcattttaattttggcatatgattatgatgatattgaagtaattcatcaatataacatctaaattatatcattaataaaggttataatatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43805796 |
atgatattgcattttaattttggcatatgattatgatgaaattgaagtaattcatc-----------taaattatatcattaataaaggttataatatct |
43805708 |
T |
 |
| Q |
101 |
aatctatcaaaattaacatgatgtttctagtatttatctaaaatttgtgacattgatgttgttgttgatgaatatctaactgtggtgttggatgatgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805707 |
aatctatcaaaattaacatgatgtttctagtatttatctaaaatttgtgacattgatgttgttgttgatgaatatctaactgtggtgttggatgatgaaa |
43805608 |
T |
 |
| Q |
201 |
cattatttataatatgtcatttgatg |
226 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
43805607 |
cattatttataatatgtcattagatg |
43805582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University