View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20893_low_4 (Length: 351)
Name: NF20893_low_4
Description: NF20893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20893_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 26 - 155
Target Start/End: Complemental strand, 17314490 - 17314363
Alignment:
| Q |
26 |
aaagagtactcacattcatgagtattcactactcacatgagtaactattctcaagacacnnnnnnnnnnnnngttcctcttcatacctccattatacacc |
125 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||| | |
|
|
| T |
17314490 |
aaagagtgcttacattcatgagtattcactactcacatgagtaactattctta-gacacctttttcctttt-gttcctcttcatacctccattatactca |
17314393 |
T |
 |
| Q |
126 |
tttgtgtgctattttgttttaaatctctct |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
17314392 |
tttgtgtgttattttgttttaaatctctct |
17314363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University