View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20894_high_6 (Length: 249)
Name: NF20894_high_6
Description: NF20894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20894_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 144 - 238
Target Start/End: Complemental strand, 43549345 - 43549253
Alignment:
| Q |
144 |
gtgtcagaattggatgatttgaagaaataagacatattttttaaccaatcaaattgcaaactgtggcattagataacaaataactgaatagaata |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43549345 |
gtgtcagaattggatgatttgaagaaataagacat--tttttaaccaatcaaattgcaaactgtggcattagataacaaataactgaatagaata |
43549253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 50901755 - 50901708
Alignment:
| Q |
153 |
ttggatgatttgaagaaataagacatattttttaaccaatcaaattgc |
200 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50901755 |
ttggaagatttgaagaaatgagacatattttttaaccaatcaaattgc |
50901708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 80
Target Start/End: Complemental strand, 43549442 - 43549409
Alignment:
| Q |
47 |
gattataaactctgcattatccttgagcatgcat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43549442 |
gattataaactctgcattatccttgagcatgcat |
43549409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University