View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20894_low_5 (Length: 263)
Name: NF20894_low_5
Description: NF20894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20894_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 9 - 163
Target Start/End: Complemental strand, 36424500 - 36424341
Alignment:
| Q |
9 |
ataatactcctctaaatatttacggggagagttttcctatg----tcattttatccgattcatgttnnnnnnncttaactttaaaatatcgttgtatttt |
104 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| ||| ||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
36424500 |
ataatactccgctaaatatttacagggagagttttcatatcccgatcattttatccgattcatgttaaaaaaactttactttaaaatatcgttgtatttt |
36424401 |
T |
|
| Q |
105 |
tcaatg-nnnnnnnaaaggtgtttatctatgattaatcnnnnnnngcaataacttctaaa |
163 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36424400 |
tcaatgttttttttaaaggtgtttatctatgattaatctttttttgcaataacttctaaa |
36424341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 230 - 263
Target Start/End: Complemental strand, 36424274 - 36424241
Alignment:
| Q |
230 |
agaaatataaagtttgtaattgttttctttctta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36424274 |
agaaatataaagtttgtaattgttttctttctta |
36424241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University