View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20895_high_9 (Length: 319)
Name: NF20895_high_9
Description: NF20895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20895_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 15 - 304
Target Start/End: Original strand, 6220759 - 6221048
Alignment:
| Q |
15 |
gaaaggaagaaaaacaaatagaaatataagaaaagaacattacaaataaggacctatttgaggagaataggagatgacagctagactgtattgtccattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220759 |
gaaaggaagaaaaacaaatagaaatataagaaaagaacattacaaataaggacctatttgaggagaataggagatgacagctagactgtattgtccattt |
6220858 |
T |
|
| Q |
115 |
cccaaacatcaccttcaacgccaaggcaaagggaccataacctttgattaaattttaaggtaaccctctatttgtcttttttattttaccatgtcttttc |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220859 |
cccaaacatcaccttcaaccccaaggcaaagggaccataacctttgattaaattttaaggtaaccctctatttgtcttttttattttaccatgtcttttc |
6220958 |
T |
|
| Q |
215 |
ttcacccttgtggaaaagctaccatgtgtgagatgtcacttagacttaacacgtggcataaatttttattagtagtacacgtggcatttt |
304 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6220959 |
ttcacccttgtggaaaagctaccatatgtgagatgtcacttagacttaacacgtggcataaatttttattagtagaacacgtggcatttt |
6221048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University