View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20896_high_9 (Length: 217)
Name: NF20896_high_9
Description: NF20896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20896_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 3881185 - 3881383
Alignment:
| Q |
1 |
gacggactgtctgaagcatcccttaattgtcctctcttgacatctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggttatcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
3881185 |
gacggactgtctgaagcatcccttaattgtcctctcttgacatctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggctatcctg |
3881284 |
T |
 |
| Q |
101 |
cttgcgtatggagtatggactgatgtttgttgttttgaattatagtcaactcaatgacgattgcttgtctgcaacaacccgtgcctgtcgactaattga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881285 |
cttgcgtatggagtatggactgatgtttgttgttttgaattatagtcaactcaatgatgactgcttgtctgcaacaacccgtgcctgtcgactaattga |
3881383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 199
Target Start/End: Original strand, 3867432 - 3867624
Alignment:
| Q |
4 |
ggactgtctgaagcatcccttaattgtcctctcttgacatctctggatgcttccttttgcaggtgatgctttatttgctagtttcttggttatcttgctt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3867432 |
ggactgtctgaagcatcccttaattgtcctctcttgacatcactggatgcttccttttgcaggtgacgctttatctgctagtttcttggttatcctgctt |
3867531 |
T |
 |
| Q |
104 |
gcgtatggagtatggactgatgtttgttgttttgaattatagtcaactcaatgacgattgcttgtctgcaacaacccgtgcctgtcgactaattga |
199 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| || ||||||| ||| || |||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3867532 |
atgtatggagtatgtactga---ttgttgttttgaattacagccaactcactgatgactgcttgtctgcaacaacccgtgcctgtccactgattga |
3867624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University