View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20896_low_8 (Length: 233)
Name: NF20896_low_8
Description: NF20896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20896_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 233
Target Start/End: Complemental strand, 39078277 - 39078065
Alignment:
| Q |
21 |
cctcccctaactttgtttgcatcatccactcatatttttcttgcaaaaaccttctgaaccccatgtgacatacatcactgatttcaatgtcctattctag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078277 |
cctcccctaactttgtttgcatcatccactcatatttttcttgcaaaaaccttctgaaccccatgtgacatacatcactgatttcaatgtcctattctag |
39078178 |
T |
 |
| Q |
121 |
tttgttgtgagttttaccatttcccattacaaacaatcttcaacttgaaagcttaaaaattctttatattatctttacaaaattttgggattctcatata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078177 |
tttgttgtgagttttaccatttcccattacaaacaatcttcaacttgaaagcttaaaaattctttatattatctttacaaaattttgggattctcatata |
39078078 |
T |
 |
| Q |
221 |
ataataaacaaca |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39078077 |
ataataaacaaca |
39078065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University