View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20897_low_10 (Length: 349)
Name: NF20897_low_10
Description: NF20897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20897_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 32346210 - 32345872
Alignment:
| Q |
1 |
tcttaatcaacttggttcttacagtggtaccataatttcgtttatttctcttaagataacacaaaaataaaatgtatactttaggatgtctacgtcagcc |
100 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32346210 |
tcttaaccaacttgattcttacagtggtaccataatttcgtttatttctcttaagataacacaaaaataaaatgtatactttaggatgtttacgtcagcc |
32346111 |
T |
|
| Q |
101 |
ttgttgttccacctttacctcattgaacctcgaaacatcttttgccttcttgaatacttgcctccaactacactgagccttttaagtagctccataactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346110 |
ttgttgttccacctttacctcattgaacctcgaaacatcttttgccttcttgaatacttgcctccaactacactgagccttttaagtagctccataactt |
32346011 |
T |
|
| Q |
201 |
atcaccattacctcttcaacctctggattgattaatttatgtcctcttgaagatcttcttgccttcaattacccttggtcttttaggaatcccacaagtc |
300 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346010 |
atcaccataacctcttcaacctctggattgattaatttatgtcctcttgaagatcttcttgtcttcaattacccttggtcttttaggaatcccacaagtc |
32345911 |
T |
|
| Q |
301 |
gttccataccttcttcaacccctgaaatgtgcttctctg |
339 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32345910 |
gtttcataccttcttcaactcctgaaatgtgcttctctg |
32345872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 319
Target Start/End: Original strand, 10456153 - 10456234
Alignment:
| Q |
239 |
atgtcctcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaac |
319 |
Q |
| |
|
||||| ||||||| |||| ||| | | |||| ||||||||||||||||| |||||||||||| || |||||| ||||||||| |
|
|
| T |
10456153 |
atgtcttcttgaatatctccttacatccaatcacccttggtcttttaggtaatcccacaagttgtgccatacattcttcaac |
10456234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 241 - 322
Target Start/End: Original strand, 37048262 - 37048344
Alignment:
| Q |
241 |
gtcctcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaacccc |
322 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| ||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
37048262 |
gtcctcttgaagattctcttgcctccaattacccttggtcttttaggtaatcccataagccattccataccttcttcaacccc |
37048344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 245 - 318
Target Start/End: Original strand, 29797096 - 29797170
Alignment:
| Q |
245 |
tcttgaagatcttcttgccttcaattacccttggtcttttagg-aatcccacaagtcgttccataccttcttcaa |
318 |
Q |
| |
|
|||||||||| | ||||| | |||||||| ||||||||||||| ||||||||||||| |||||||| ||| |||| |
|
|
| T |
29797096 |
tcttgaagatttccttgcatgcaattaccattggtcttttaggtaatcccacaagtcattccatacattcctcaa |
29797170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University