View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20897_low_13 (Length: 248)
Name: NF20897_low_13
Description: NF20897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20897_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 26645307 - 26645536
Alignment:
| Q |
1 |
aactatcgagcatattggaaggttgactatgcaatgcggtgagtaataacatttatgtggtattcctctctctctcactaaactccttacaaacatggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26645307 |
aactatcgagcatattggaaggttgactatgcaatgcggtgagtaataacatttatgtgatattcctctctctctcactaaactcaatacaaacatggga |
26645406 |
T |
 |
| Q |
101 |
agacatggaaatgtgtttccatgacaggttatattggccttagcctaaggttaaggtaactgatttgatgaatctgaagca----ataactagatgaatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
26645407 |
agacatggaaatgtgtttccatgacaggttatattggccttagcctaaggttaaggtaactgatttgatgaatctaaagcaatatataattagatgaatc |
26645506 |
T |
 |
| Q |
197 |
acttgatgacttcattggaaaacagatggg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26645507 |
acttgatgacttcattggaaaacagatggg |
26645536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University