View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20897_low_7 (Length: 466)
Name: NF20897_low_7
Description: NF20897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20897_low_7 |
 | |
|
| [»] scaffold0065 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 6e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 249 - 410
Target Start/End: Complemental strand, 26644302 - 26644142
Alignment:
| Q |
249 |
aacccgcgtggggtaatacatatgcatcatgttgtgatatggatgttgtaggattatctgatacatgtggatactaccgaagtttgttaatgtatgcctc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26644302 |
aacccgcgtggggtaatacatatgcatcatgttgttatatggatgttgtaggatgatctgatacatgtggatacgaccgaagtttgttaatgtatgcctc |
26644203 |
T |
|
| Q |
349 |
aacaaaaatatttactgtgcgaaaatacatttctccccccaatgagtttatgtcagctcaac |
410 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26644202 |
aac-aaaatatttactgtgcgaacatacatttctccccccaatgagtttatgtcagctcaac |
26644142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 660 - 703
Alignment:
| Q |
1 |
gtaccaataaacatttaatttaaaaccattacacaattatcttg |
44 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
660 |
gtaccaataataatttcatttaaaaccattacacaattatcttg |
703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University