View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20899_high_3 (Length: 344)
Name: NF20899_high_3
Description: NF20899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20899_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 30 - 335
Target Start/End: Complemental strand, 3863449 - 3863143
Alignment:
| Q |
30 |
gagtgtgcaggtgataactgaatttaaacttcaaaattcttgtatgcaaacggatgctgcagtggttgtacaatcacaaggaagtggcaacattagagct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863449 |
gagtgtgcaggtgataactgaatttaaacttcaaaattcttgtatgcaaacggatgctgcagtggttgtacaatcacaaggaagtggcaacattagagct |
3863350 |
T |
|
| Q |
130 |
tgtagtttcggacagcctcatgttgctgaaccagattagcagtacctgtttgatatattggtaggaacctt-atcttgtagctcatgaattacttcactt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3863349 |
tgtagtttcggacagcctcatgttgctgaaccagactagcagtacctgtttgatatattggtaggaaccttaatcttgtagttcatgaattacttcactt |
3863250 |
T |
|
| Q |
229 |
tcttacttctgttggtagcaaaacttacctggggaattccctaagcccctacgaaagtagtattcaatatcatttaggaaatgttaaagactgtccttag |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
3863249 |
tcttacttctgttggtagcaaaacttacctggggaattccctatgcccctacgaaagtagtattcaatatcgtttagaaaatgttaaagaatgtccttag |
3863150 |
T |
|
| Q |
329 |
cgcattg |
335 |
Q |
| |
|
|||||| |
|
|
| T |
3863149 |
tgcattg |
3863143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University