View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20899_high_7 (Length: 316)
Name: NF20899_high_7
Description: NF20899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20899_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 28 - 305
Target Start/End: Complemental strand, 10913962 - 10913686
Alignment:
| Q |
28 |
cagggatatattggttgtaaaacacattgtttctgtatgattctctttacataccttacatattacctctgcactttttatgtattgcatggtgggatga |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
10913962 |
cagggatatattggttgtaaaacacattgtttctgtatgattctctttacataccttacatattacctctgcactttttatgtattgcatggggggttga |
10913863 |
T |
|
| Q |
128 |
aacttttttatttattttacattcatgccattctctataaatttgataagactcaaggctaaggaactttgtccaatcaattcagaattnnnnnnnnnnt |
227 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
10913862 |
aacctttttatttattttacattcatgccattctctataaatttgataagactcaaggctaaggaactttgtccaatcaatttagaatt-aaaaaaaaat |
10913764 |
T |
|
| Q |
228 |
atacatgattggaagttcagaatctttagttcctatcagtaaaaggcatttcacgcctttgatttgcaggcgtctgtg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10913763 |
atacatgattggaagttcagaatctttagttcctatcagtaaaaggcatttcacgcctttgatttgcaggcgtctgtg |
10913686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University