View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2089R-Insertion-10 (Length: 130)
Name: NF2089R-Insertion-10
Description: NF2089R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2089R-Insertion-10 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 2e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 9 - 130
Target Start/End: Complemental strand, 8400875 - 8400754
Alignment:
| Q |
9 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggtttcctattgctattgtggtttcgatgtgagacttaagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || || ||||||||| |
|
|
| T |
8400875 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggtttcctattgctattgttgtttcaatctgtgacttaagc |
8400776 |
T |
|
| Q |
109 |
tgtttgaacaatcttgttgcat |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8400775 |
tgtttgaacaatcttgttgcat |
8400754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 9 - 130
Target Start/End: Original strand, 8368535 - 8368656
Alignment:
| Q |
9 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggtttcctattgctattgtggtttcgatgtgagacttaagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| || |||||||||||| |
|
|
| T |
8368535 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggttaccaattgctattgtagtttcaatctgagacttaagc |
8368634 |
T |
|
| Q |
109 |
tgtttgaacaatcttgttgcat |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8368635 |
tgtttgaacaatcttgttgcat |
8368656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 9 - 130
Target Start/End: Complemental strand, 8422452 - 8422331
Alignment:
| Q |
9 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggtttcctattgctattgtggtttcgatgtgagacttaagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| || || ||||||||| |
|
|
| T |
8422452 |
ataagctctatcaagagctagaacttcttgaatagtatcctttatatattcctctgtggggttcccaattgctattgttgtttcaatctgggacttaagc |
8422353 |
T |
|
| Q |
109 |
tgtttgaacaatcttgttgcat |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8422352 |
tgtttgaacaatcttgttgcat |
8422331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University