View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2089R-Insertion-7 (Length: 248)
Name: NF2089R-Insertion-7
Description: NF2089R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2089R-Insertion-7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 6634423 - 6634634
Alignment:
| Q |
9 |
catcattcttagcctcaacaaagtagaaaaagagtgcttttttgttttgatcatcaacatttacataacctgaaaagtgatgaaaatcaacatgtggttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6634423 |
catcattcttagcctcaacaaagtagaaaaagagtgcttttttgttttgatcatcaacatttacataacctgaaaactgatgaaaatcaacatgtggttg |
6634522 |
T |
 |
| Q |
109 |
accaggtaaatttgtgatcttattagggtgtgaaactgcaaaggaacattggtgaagcataattgcagcaacacacattgcaatagaacaacaaagtaga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634523 |
accaggtaaatttgtgatcttattagggtgtgaaactgcaaaggaacattggtgaagtataattgcagcaacacacattgcaatagaacaacaaagtaga |
6634622 |
T |
 |
| Q |
209 |
aaagacatggtt |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6634623 |
aaagacatggtt |
6634634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University