View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2089_low_5 (Length: 289)
Name: NF2089_low_5
Description: NF2089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2089_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 5 - 141
Target Start/End: Complemental strand, 17725353 - 17725214
Alignment:
| Q |
5 |
catgggttcttcactcttgatccaaattcagaaccatcaaaagaattgatgttgttcatcaagcaattcattgaaaaatattgaggg---aatgtttgaa |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
17725353 |
catgggttcttcactattgatccaaattcagaaccatcaaaagaattgatgttggtcatcaagcaattcattgagaaatattaagggaataatgtttgaa |
17725254 |
T |
 |
| Q |
102 |
tgcttcaaacattttaattgcagtagcttttaaggtatct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17725253 |
tgcttcaaacattttaattgcagtagcttttaaggtatct |
17725214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University