View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2089_low_9 (Length: 250)
Name: NF2089_low_9
Description: NF2089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2089_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 8695495 - 8695732
Alignment:
| Q |
13 |
aatatgcaacttttgtgatatacaaccatgctctttttagaatgtgtcacctcacctagatcctctattaatgtggccttactggattaccactcataac |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8695495 |
aatatgcaacttttatgatatacaaccatgctctttttagaatgtgtcacctcacctagatcctctattaatgtggccttactagattaccactcataac |
8695594 |
T |
 |
| Q |
113 |
cacctaaaaccccgctaccaaacacacgatcttcaaattatttaaccattaccaaccaacgaaatactcaacaacaaaatatatgtagcataaatattac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8695595 |
cacctaaaaccccgctaccaaacacacggtcttcaaattatttaaccattaccaaccaacgaaatactcaacaacaaaatataggtagcataaatattac |
8695694 |
T |
 |
| Q |
213 |
ttttaacatagatagtaatggagttaatcttacattca |
250 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8695695 |
tgttaacatagatagtaatggagttaatcttacattca |
8695732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University