View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20900_high_15 (Length: 202)
Name: NF20900_high_15
Description: NF20900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20900_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 184
Target Start/End: Complemental strand, 38385855 - 38385685
Alignment:
| Q |
14 |
aagcaaaggcgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgtgatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38385855 |
aagcaaaggcgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacagacactgcaattgtgatc |
38385756 |
T |
 |
| Q |
114 |
tcaccattgctgaggatagaaataacactactactgcagaaggcgtcaatgtcgatgtggaacatgattct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38385755 |
acaccattgctgaggatagaaataacactactactgcagaaggcgtcaatgtcgacgtggaacatgattct |
38385685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 29439074 - 29438979
Alignment:
| Q |
14 |
aagcaaaggcgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29439074 |
aagcaaagacgtgaacatgatgaaaatatagtcgctttgcctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
29438979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University