View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20900_high_9 (Length: 256)
Name: NF20900_high_9
Description: NF20900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20900_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 46737013 - 46737263
Alignment:
| Q |
1 |
tttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgctcatagaaaaccatgtatggatcatgatcacattccatattaatgaaggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46737013 |
tttttgaacagaacgtggatgaatgctatatcaacaggggatgttgttgctcatagaaaaccatgtatggatcatgatcgcattccatattaatgaaggc |
46737112 |
T |
|
| Q |
101 |
atctgcactaccattagtttcacggtacacatgacacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagcctccaccaatct |
200 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737113 |
atctgcacaaccattagcttcacggtacacatgacacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagcctccaccaatct |
46737212 |
T |
|
| Q |
201 |
gtcaacactgtattaggatcaagaatattttcagctaccacctttgcttct |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737213 |
gtctacactgtattaggatcaagaatattttcagctaccacctttgcttct |
46737263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University