View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20901_high_13 (Length: 317)
Name: NF20901_high_13
Description: NF20901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20901_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 10520643 - 10520506
Alignment:
| Q |
10 |
attattcttgttgggttgcgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcttatagcgagc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10520643 |
attattcttgttgggttgcgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcgtatagcgagc |
10520544 |
T |
 |
| Q |
110 |
ttccggatagtgtgaggcttaatgaaggaattggtggt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10520543 |
ttccggatagtgtgaggcttaatgaaggaattggtggt |
10520506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 217 - 297
Target Start/End: Complemental strand, 10520436 - 10520356
Alignment:
| Q |
217 |
aagatttgaggggttcgtgnnnnnnngttcaaaagatgggnnnnnnnnataagttttatggtatgatcatgatgatgatgt |
297 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10520436 |
aagatttgaggggttcgtgtttttttgttcaaaagatgggttttttttataagttttatggtatgatcatgatgatgatgt |
10520356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 28 - 147
Target Start/End: Original strand, 241601 - 241720
Alignment:
| Q |
28 |
cgtgattatcaggatgataaggctgatgtgatcttgaagtatatgccggatgaggccagattgttgaaggcttatagcgagcttccggatagtgtgaggc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| || | |||||||||||| ||| ||||||| | | |||| |
|
|
| T |
241601 |
cgtgattatcaggatgataaggctgatgtgatattgaaatatatgccggatgaggcgaggctattgaaggcttatgatgagattccggaatctattaggc |
241700 |
T |
 |
| Q |
128 |
ttaatgaaggaattggtggt |
147 |
Q |
| |
|
|||||||||| |||| |||| |
|
|
| T |
241701 |
ttaatgaaggtattgctggt |
241720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University