View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_high_26 (Length: 242)
Name: NF20902_high_26
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 44 - 240
Target Start/End: Complemental strand, 11826613 - 11826417
Alignment:
| Q |
44 |
gtgtcgttgattactttatatatgttaaaattttcatagctagatcaatgaaatatttctacttccaagatatcttttttgctgttgtacattttggcat |
143 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826613 |
gtgtcgttgattgctttatatatgttgaaattttcatagctagatcaatgaaatatttctacttccaagatatcttttttgctgttgtacattttggcat |
11826514 |
T |
|
| Q |
144 |
aaaaaatgtcagtattgtattgttagtttttatattgagggtggggatcaaactattgatttccttattattcacccttatattccctttttctgtg |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826513 |
aaaaaatgttagtattgtattgttagtttttatattgagggtggggatcaaactattgatttccttattattcacccttatattccctttttctgtg |
11826417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 108
Target Start/End: Complemental strand, 11840389 - 11840334
Alignment:
| Q |
49 |
gttgattactttatatatgttaaaattttcatagctagatcaatgaaatatttctacttc |
108 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11840389 |
gttgattgctttatatatgttgaaattttca----tcgatcaatgaaatatttctacttc |
11840334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 11826654 - 11826625
Alignment:
| Q |
1 |
attaattagtgcactttgttattttgctgt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11826654 |
attaattagtgcactttgttattttgctgt |
11826625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 196
Target Start/End: Original strand, 35040359 - 35040395
Alignment:
| Q |
160 |
gtattgttagtttttatattgagggtggggatcaaac |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35040359 |
gtattgttagtttttatgctgagggtggggatcaaac |
35040395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University