View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_high_32 (Length: 236)
Name: NF20902_high_32
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 27312764 - 27312560
Alignment:
| Q |
15 |
catcatctgctttcgaactttatcgggtaatctcaatgtaaacctctcacaatcctcacctggttgcaccaacacacctgttgagtttgaccgtgataac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312764 |
catcatctgctttcgaactttatcgggtaacctcagtgtaaacctctcacaatcctcacctggttgcaccaacacacctgttgagtttgaccgtgataac |
27312665 |
T |
 |
| Q |
115 |
aagagaatagataagaatcctgttgatcttgaccgtgttggtgcagaatatgttttagacctatgaagtacatctaccttaggtgaattttccacttcca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312664 |
aagagaatagataagaatcctgttgatcttgaccgtgttggtgcagaatatgttttagacctacgaagtacatctaccttaggtgaattttccacttcca |
27312565 |
T |
 |
| Q |
215 |
cgttg |
219 |
Q |
| |
|
||||| |
|
|
| T |
27312564 |
cgttg |
27312560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University