View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_17 (Length: 288)
Name: NF20902_low_17
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 22 - 271
Target Start/End: Complemental strand, 38324369 - 38324120
Alignment:
| Q |
22 |
acacttgtaacaccgatattttaaactgaaggcgtgtccaacaatgttgggcactcaaaattcgtgtttggtgtccatttctgtccttcataagacatac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324369 |
acacttgtaacaccgatattttaaactgaaggtgtgtccaacaatgttgggcactcaaaattcgtgtttggtgtccatttctgtccttcataagacataa |
38324270 |
T |
 |
| Q |
122 |
cagtctacacaagtttctgatctccgcaacagcaatacaccttttctcttaaaaaatcaaaactttaccaaattggatacacattccattgcccgcctta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324269 |
cagtctacacaagtttctgatctccgcaacagcaatacaccttttctcttaaaaaatcaaaactttaccaaattggatacacattccattgcccgcctta |
38324170 |
T |
 |
| Q |
222 |
tcagtaacctccaaccacatagaagcaacaacacttgtttccaataaaca |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38324169 |
tcagtaacctccaaccacagagaagcaacaacacttgtttccaataaaca |
38324120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University