View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_18 (Length: 286)
Name: NF20902_low_18
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 71 - 259
Target Start/End: Original strand, 13049622 - 13049809
Alignment:
| Q |
71 |
gtataaaaaatcacaagtctcattaccaacttaaggattaatttcataacaagttcaaaggatataaatgtatgggggatactgcagaagatgcaatggt |
170 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||| ||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
13049622 |
gtatataaaatcacacgtcttattaccaacttaaggattaatttcataacaaattcaaaggatgtaaatttat-ggggataccgcagaggatgcaatggt |
13049720 |
T |
|
| Q |
171 |
agccaaaggccctataactatggt-ggttagcnnnnnnnnttcccttgttatgagttttaaattgtagtaggagccagtagtacttgaat |
259 |
Q |
| |
|
||||||||| ||||| ||||| || ||||||| | ||||||||||||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
13049721 |
agccaaagg-cctatgactatagtaggttagcaaaaaatatacccttgttatgagttttaaattgtagtgagagccaatattacttgaat |
13049809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University