View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_22 (Length: 247)
Name: NF20902_low_22
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 55193221 - 55193479
Alignment:
| Q |
1 |
gcagtgaaagggaataagccaaaaacgacctacagattcttcgataagatggaat------------aaaata-------ggaaaggttgagcaaacaga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| ||| |
|
|
| T |
55193221 |
gcagtgaaagggaataagccaaaaacgacctacagattcttcgataagatggaatttattcataggaaaagtacaacaccggaaaggttgagcaaataga |
55193320 |
T |
 |
| Q |
82 |
acaacccaaagtgggaaatttgtcaaatcagctacgtcttaggacaacagctttccaattgcatttcatagacattaattggatactaaccatacccacc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55193321 |
acaacccaaagtgggaaatttgtcaaatcagctacgtcttaggacaacagctttccaattgtatttcatagacattaattggatactaaccatacccacc |
55193420 |
T |
 |
| Q |
182 |
aattaatcaatcactagagtccatctaataatataagattattactttttccacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55193421 |
gattaatcaatcactagagtccatctaataatataagattattactttttccacctatg |
55193479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University