View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_25 (Length: 243)
Name: NF20902_low_25
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 6595505 - 6595283
Alignment:
| Q |
11 |
tagaaataagttacaacctcgtttaacaccttgtatcttcttaggatatccatcaaatcttagaggacacaaacgttataagtaatctagccgtaaaata |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
6595505 |
tagaaataagttacaacctcgttgaacaccttatatcttcttaggatatccatcaaatcatagaggacataaacgttacaagtaatctagccgtaaaata |
6595406 |
T |
|
| Q |
111 |
tttattttccgacatgttatttttgaagaaaatacattccttttgact-attcaaatgttcctacaacggttggttataattttttggataatgatacac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6595405 |
tttattttccgacatgttatttttgaagaaaatacattccttttgactaattcaaatgttcctacaacggttggttataattttttggataatgatacac |
6595306 |
T |
|
| Q |
210 |
ccttccttccatcccaaacctat |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6595305 |
ccttccttccatcccaaacctat |
6595283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University